SPECIAL ISSUE
Microbial diversity on a marble monument: a case study
Christine Hallmann • Jo¨rg Ru¨drich •
Matthias Enseleit • Thomas Friedl •
Michael Hoppert
Received: 30 April 2010 / Accepted: 27 September 2010 / Published online: 17 October 2010
 The Author(s) 2010. This article is published with open access at Springerlink.com
Abstract In the presented case study, ascomycete fungi
and green algae on a marble monument were identified by
comparisons of the 18S rRNA gene sequences, which were
obtained from DNA either from environmental samples or
from enrichment cultures. The organisms were found to be
responsible for either black or green surface coverings on
different areas of the monument surface. Most fungi were
related to plant-inhabiting genera, corresponding to a heavy
soiling of the marble surface with honeydew. Whereas
green algae of the genera Stichococcus, Chloroidium and
Apatococcus were found to be dominant in all samples,
isolates of two additional genera were recovered only from
enrichment cultures. A reference strain of Apatococcus
lobatus and an isolate of Prasiolopsis sp. were investigated
with respect to putative surface adhesive structures of the
cell envelope. The Prasiolopsis cell walls were covered
with a thin adhesive exopolysaccharide layer involved in
biofilm formation.
Keywords Marble monument  Biofilm  Ascomycete
fungi  Green algae  Cell wall  Exopolysaccharide
Introduction
Biodeterioration of dimension stone primarily affects
material surfaces. Some endolithic organisms actively
penetrate the surface and are also found in layers up to
several millimeters underneath the surface (e.g., Ascaso
et al. 1998; Hoppert et al. 2004a). Though several impor-
tant pro- and eukaryotic organisms have already been
recognized as deteriorative agents, up to now little is
known about the whole microbial community (see Gor-
bushina 2007 and Macedo et al. 2009 for review). It must
be expected that a microbial biofilm is composed of at least
several dozens of species. These various organisms act in
different ways on the material; a whole spectrum of dete-
riorative activities may be expected: from neutral (or even
protective, e.g. Zuo et al. 2005) to deteriorative by pene-
tration of the surface (Warscheid and Braams 2000; Ke-
mmling et al. 2004). It remains difficult to assign the
deteriorative activity to a certain microbial species within a
biofilm. Microbial activity also varies over seasons and is
influenced by rainfall, surface cleaning or input of nitrogen,
phosphate and other essential compounds.
The present case study aims at the identification of
organisms by two complementary approaches: analyses of
18S rDNA sequences (either directly from environmental
DNA or via enrichment culture) and isolation of strains. The
former approach is inevitable for elucidation of microbial
diversity, since most (pro- and eukaryotic) microorganisms
C. Hallmann  T. Friedl
Abt. Experimentelle Phykologie und Sammlung fu¨r
Algenkulturen, Albrecht-von-Haller-Institut fu¨r
Pflanzenwissenschaften, Georg-August-Universita¨t Go¨ttingen,
Untere Karspu¨le 2, 37073 Go¨ttingen, Germany
J. Ru¨drich
Abt. Strukturgeologie und Geodynamik, Geowissenschaftliches
Zentrum Go¨ttingen, Georg-August-Universita¨t Go¨ttingen,
Goldschmidtstr. 1, 37077 Go¨ttingen, Germany
M. Enseleit  M. Hoppert (&)
Institut fu¨r Mikrobiologie und Genetik,
Georg-August-Universita¨t Go¨ttingen,
Grisebachstraße 8, 37077 Go¨ttingen, Germany
e-mail: mhopper@gwdg.de
M. Hoppert
Courant Research Centre Geobiology,
Georg-August-Universita¨t Go¨ttingen,
37077 Go¨ttingen, Germany
123
Environ Earth Sci (2011) 63:1701–1711
DOI 10.1007/s12665-010-0772-3
are unculturable. The latter, ‘‘classical’’ approach underes-
timates the diversity as it recovers too few of the actually
present species, but has two advantages. It enables studying
the physiology of organisms in pure culture and allows
recovering and identification of species that are present on
the surface in such low numbers of individuals that they
escape DNA extraction and sequencing. These species may
actually not have an important role in the biofilm at the time
of sampling, but may be present as resting stages and
become more abundant when the environmental conditions
(e.g., insolation, humidity) change.
For the present case study, a marble sculpture, which is
part of the monument ‘‘Gegendenkmal’’ (Fig. 1a; Ham-
burger Dammtordamm, created by Alfred Hrdlicka
1983–1986), was selected. The object is covered with
grayish and black crusts of hitherto unknown origin as well
as greenish (obviously algal) biofilms. The aim of this case
study was the application of both molecular and
A
B C
D E 500 µm500 µm
Fig. 1 The monument and
macroscopically visible surface
stains. a The monument
‘‘Gegendenkmal’’, created by
Alfred Hrdlicka 1983–1986,
located in Hamburg-Altona. The
marble sculpture at the left is
nearly completely covered with
a dark gray/black stain. b, c Part
of the sculpture ‘‘Hamburger
Feuersturm’’ with a green
(b) and dark-grayish (c) surface
stain, as marked by arrows. (d,
e) Thin petrographic sections
perpendicular to the surface
from an area as depicted in (c).
Small fragments, embedded in a
dark matrix, adhere to the
surface (arrows, d).
Microfractures along grain
boundaries, filled with a dark
matrix (arrows)
1702 Environ Earth Sci (2011) 63:1701–1711
123
enrichment/isolation approaches to identify the organisms
and to characterize cell wall features that are possibly rel-
evant to biofilm formation. Here, we focus on green algal
and fungal organisms. Members of these groups dominate
the biofilm, from the first microscopic inspection of the
surface, with by far highest biomasses.
Materials and methods
Sampling
The sampling site was in Hamburg Dammtor (533304300N,
95902700E). Samples (approximately 100 ll dry volume)
were collected in May 2008 from an SSW exposed part of
the sculpture called ‘‘Hamburger Feuersturm’’. The sam-
ples were taken from two sites as depicted in Fig. 1b, c.
Areas of 1 cm2 from a green surface covering (Fig. 1b,
sample A) and from a dark gray/black covering (Fig. 1c,
sample B), respectively, were scraped off with a sterile
scalpel. The samples were stored at ambient temperature in
sterile 2-ml reaction tubes.
Cultivation and isolation
For the cultivation of microalgae, small amounts of the
biofilm samples were either directly plated on agarized
(1.5%) culture medium MIEB12 (Schlo¨sser 1994) in Petri
dishes, or inoculated in 10 ml volumes of liquid MIEB12
medium in culture tubes (enrichment culture). Cultures
were kept under continuous illumination (25 lmol photons
m-2 s-1, white fluorescent tubes) and 18C for 4 weeks.
From the liquid cultures, 100 ll aliquots were then plated
on solid MIEB12 medium and incubated under the same
conditions as for liquid media. Single colonies of different
appearance were selected and transferred on fresh agar
plates until unialgal cultures were obtained.
A reference stain, Apatococcus lobatus SAG 2037, was
taken from the Culture Collection of Algae (SAG; Georg-
August-Universita¨t Go¨ttingen, Germany) and cultured on
agarized or liquid Bold’s Basal medium with vitamins
(Schlo¨sser 1994).
Nucleic acid extraction, PCR, cloning and sequencing
DNA was extracted from the environmental samples as
well as from the liquid cultures. All steps were performed
with sterilized (autoclaved, nuclease-free) reagents. For
DNA extraction, equivalents of 20–50 ll packed cell vol-
ume, either obtained from the original biofilm or from
liquid cultures, were used. The biofilm samples or pelleted
cells were resuspended in 100 ll lysis buffer (Invisorb Spin
Plant Mini Kit, Invitek, Berlin, Germany). After one vol-
ume of resuspended cells was mixed with an approximately
equivalent volume of glass beads (425–600 lm diameter;
acid-washed beads, Sigma–Aldrich, St. Louis, MO, USA)
and vortexed briefly, the cells were mechanically disrupted
by shaking in a Minibeadbeater (Biospec, Bartlesville, OK,
USA) in several intervals of 30 s and one interval of 50 s at
5,000 rpm. DNA was then extracted with the Invisorb Spin
Plant Mini Kit (Invitek, Berlin, Germany) in the extraction
buffers, following the manufacturer’s instructions. Results
were checked on a 1% (w/v) agarose gel. Isolated DNA
was stored at -20C until further processing. The
eukaryote-specific primer combinations NS1?18L and
NS1?LR 1850 were used (Table 1) to amplify the 18S and
the 18S with adjacent ITS-1/5.8S/ITS-2 regions of rDNA,
respectively.
About 30 ng of the extracted DNA was used as tem-
plate. The amplification reaction mixture (50 ll) contained
each deoxynucleotide triphosphate at a concentration of
0.1 mM, 5 ll of tenfold concentrated reaction buffer,
2 mM MgCl2, 0.2 lM primers, 2 U of Taq DNA poly-
merase (reagents and manufacturer’s protocol: Bioline,
Luckenwalde, Germany) and 4% (v/v) dimethyl sulfoxide
(DMSO)-solution. Polymerase chain reaction was carried
out on a PTC 200 thermocycler (MJ Research, Waltham,
MA, USA) using the following program for the primer pair
NS1?LR1850: initial denaturation at 95C for 5 min,
followed by 33 cycles of denaturation at 94C for 40 s,
annealing at 52C for 90 s, extension at 72C for 90 s,
followed by 6 cycles of denaturation at 94C and final
extension at 72C for 2 min. For the primer pair NS1?18L,
denaturation was for 1 min, annealing for 45 s, extension
for 3 min, the additional 6 cycles were omitted and final
Table 1 Primers used in this
study
Primer Sequence 50-30 Reference
NS1 (forward) GTAGTCATATGCTTGTCT White et al. (1990)
18L (reverse) CACCTACGGAAACCTTGTTACGACTT Hamby et al. (1988)
LR1850 (reverse) CCTCACGGTACTTGTTC Friedl (1996)
M13F (forward) TGTAAAACGACGGCCAGT Invitrogen
M13R (reverse) GGCAGGAAACAGCTATGACC Invitrogen
895R (sequencing primer) GAGGTGAAATTCTTGGATTT SAG
Environ Earth Sci (2011) 63:1701–1711 1703
123
extension was for 7 min. The PCR products were purified
using the Invisorb Spin PCRapid Kit (Invitek, Berlin,
Germany). Aliquots (2 ll) of purified amplicons were
analyzed by electrophoresis on a 1% (w/v) agarose gel.
Cloning of the PCR product was performed with the TOPO
TA cloning kit (Invitrogen, Carlsbad, CA, USA) and the
pCR2.1-TOPO vector. Ligations were transformed into
competent cells of Escherichia coli TOP 10, as supplied by
the manufacturer. In the plasmid screening, white E. coli
colonies containing correct DNA insertions were identified
by direct amplification of the inserted DNA fragment with
a vector-specific primer set M13F/M13R (Table 1).
Clones were cultivated overnight in LidBac reaction
tubes (Qiagen, Hilden, Germany) with 1 ml LB medium
containing 100 lg ampicillin. Plasmid DNA was prepared
from the clones with a NucleoSpin-Plasmid kit (Macherey
and Nagel, Du¨ren, Germany) following the manufacturer’s
instructions.
Sequencing reactions were performed with a Dye Ter-
minator Cycle Sequencing v3.1 kit (Applied Biosystems,
Darmstadt, Germany) and an ABI Prism 3100 (Applied
Biosystems) automated sequencer. All clones were
sequenced with the 18S sequencing primer 895R (Table 1)
resulting in about 600 bp sequences. Sequences were pro-
cessed using the sequence analysis program SeqAssem
(Sequentix, Klein Raden, Germany) and manually aligned
using the program BioEdit v7.0.5.3 (Meusnier et al. 2008).
The final sequences were compared by BLASTn analysis
[National Center for Biotechnology Information (NCBI),
http://www.ncbi.nlm.nih.gov].
Light and electron microscopy
For fluorescence light microscopy, cells taken from unial-
gal or pure cultures were marked with concanavalin A,
coupled to fluorescein isothiocyanate (Con A-FITC;
Sigma–Aldrich). The dye was applied in 50 mM potassium
phosphate buffer, supplemented with 10 lM magnesium
chloride and 10 lM calcium chloride at a dilution of 1/
1,000 of the original stock solution. The sample was
inspected under a fluorescence light microscope (Axio-
scope, Zeiss, Go¨ttingen, Germany; excitation wavelength
495 nm, emission wavelength 517 nm, Zeiss filter set 09).
Petrographic thin sections of approximately 30 lm in
thickness were performed according to established proce-
dures (Adams et al. 1984) and visualized by standard bright
field microscopy.
For electron microscopy, cells from unialgal or pure
cultures were harvested by centrifugation at 10,0009g,
resuspended in 50 mM potassium phosphate buffer,
chemically fixed in 0.5% (w/v) formaldehyde and 0.3% (w/
v) glutaraldehyde solution for 90 min at 0C, dehydrated in
a graded methanol series and embedded in Lowicryl K4M
resin (Roth et al. 1981; Hoppert and Holzenburg 1998).
Resin sections of 80–100 nm thickness were cut with glass
knives. Localization studies were performed with the lectin
concanavalin A (Sigma–Aldrich), coupled to colloidal gold
(Con A-Gold), as already described (Ka¨mper et al. 2004).
In brief, sections were incubated on drops of dilutions (1/
10, 1/100, 1/1,000) of the Con A-gold marker for 90 min,
then washed for 5 min per step for three times on drops of
PBS containing 0.01% (v/v) Tween 20. Finally, the sec-
tions were stained with 0.5% (w/v) phosphotungstic acid,
pH 7.0, for 3 min. Electron microscopy was performed in a
Zeiss EM 902 transmission electron microscope (Zeiss
SMT, Oberkochen, Germany), equipped with a 1 K digital
camera, at 80 kV acceleration voltage and at calibrated
magnifications.
Results
Diversity of fungal and algal organisms
The monument ‘‘Gegendenkmal’’ consists of several
bronze and marble sculptures. In this study, the sculpture
‘‘Hamburger Feuersturm’’, made of Carrara marble, was
under investigation. The sculpture showed a mixture of
greenish and grayish/black stains (Fig. 1), as well as
green layers on the fracture surfaces of chips and scales
(cf. Warscheid and Braams 2000). The sculpture was
manufactured from Bianco Carrara C, a pure calcite
marble, as determined by X-ray diffractometry (data not
shown).
Thin petrographic sections, perpendicular to the surface,
show open grain boundaries between the calcite crystals in
the marble microstructure (Fig. 1d, e), which illustrates the
increased porosity and a slight sugar-like crumbling of the
marble surface. The grayish stain, mainly on the top parts
of the marble sculptures, was the most obvious feature
(Fig. 1a, c). In petrographic sections, the stain appears to
be homogeneous, slightly red-brown and translucent. It
encloses crystals on the marble surface (Fig. 1d) and
infiltrates the surface along open grain boundaries
(Fig. 1e). Though the cause of this heavy soiling could not
be identified, it was observed that honeydew covered the
sculptures in the affected areas. The honeydew was drip-
ping off a plane tree canopy (Platanus 9 hispanica),
placed directly above the monument, as well as a lime tree
canopy (Tilia platyphyllos) nearby. Another obvious fea-
ture was represented by green stains of algal biofilms,
primarily growing in cavities, where water cannot drain off
fast. To investigate the participation of microorganisms in
these surface coverings, material from approximately
1 cm2 surface was used for further processing. Green layers
under scales were not enclosed in this study, because they
1704 Environ Earth Sci (2011) 63:1701–1711
123
represented just a small fraction of the (putatively) bio-
genic stains. Sample A was taken from a green algal bio-
film (Fig. 1b) and sample B from the black covering as
depicted in Fig. 1c.
The samples were first inspected by light microscopy to
verify the presence of dominant species. Actually, green
algal (sample A) and fungal (sample B) morphotypes
dominated the microbial biomass of the biofilm (Fig. 2a,
b). Thus, our further studies aimed at the identification of
the species from both these groups. Most of the algal
morphotypes correspond to Apatococcus and Chloroidium
ellipsoideum (Darienko et al. 2010). No stratification of the
biofilms could be observed: filamentous fungi (if present)
and green algae were interwoven in a homogeneous surface
covering. In enrichment cultures, inoculated with samples
from the original biofilm, besides Chloroidium-morpho-
types, rod-shaped Stichococcus-like cells dominated
(Fig. 2c). Unialgal cultures could be obtained for some of
the dominant Stichococcus and Apatococcus like morpho-
types (cf. Fig. 3a, b). In addition, a xanthophyte alga
(Fig. 3c) and a Prasiolopsis (Pseudopleurococcus)-like
morphotype (Fig. 3d; see below) could be isolated.
Sequences obtained from clone libraries of environ-
mental DNA samples also recovered Stichococcus (S.
mirabilis related) and Apatococcus, however, failed to
detect Prasiolopsis and xanthophytes (Table 2). Instead,
Trebouxia (a frequent lichen alga) was found. Besides the
dominating Stichococcus spp. algae, a variety of ascomy-
cete fungi was found exclusively in sample B. Among the
fungi, members of the ascomycete genera, Batcheloromy-
ces, Teratosphaeria, Thelocarpon and Sarcinomyces, were
recovered, each with more than one clone. Batcheloromy-
ces, Teratosphaeria and Guignardia are known as plant-
inhabiting ascomycetes (Crous et al. 2004). Thelocarpon
represents a lichenicolous ascomycete genus. The genus
Sarcinomyces describes black yeasts from various habitats
(Cooke 1961).
The clone libraries from the enrichment cultures
showed lower diversities. Stichoccoccus bacillaris-like
algae were dominant (Table 3) and no fungal organisms
could be detected. It has to be stated, nevertheless, that
not all organisms could be assessed by the clone bank
analysis. The observed xanthophycean algae as well as
Prasiolopsis, which were observed in the cultures, were
not recovered by clone libraries from environmental
samples. The identity of the Prasiolopsis genus was
confirmed by 18S rDNA sequencing of preparations
obtained from unialgal cultures.
Cell surface features of selected species
The branched filamentous Prasiolopsis was selected for
further morphological studies. The organism was
compared with a contrasting morphotype, represented by
Apatococcus lobatus SAG 2037, which forms irregular
packages consisting of several dozens of cells (Figs. 3b,
4a). These algae represent the most different biofilm
morphotypes in this study, i.e., unicellular coccoid and
10 µm
10 µm
A
C
10 µmB
Fig. 2 Microscopic analysis of environmental samples and enrich-
ment cultures. a Agglomeration of coccoid algae taken from the
marble surface. b Ascomycete fungal morphotype (putative conidial
fragment) taken from the surface. c Unicellular green algal morpho-
types in an enrichment culture
Environ Earth Sci (2011) 63:1701–1711 1705
123
branched filamentous (Figs. 3b, d, 4). With respect to
biofilm formation, we were particularly interested in cell
surface features that are involved in adhesion, such as
secreted polysaccharides (e.g., Tsuneda et al. 2003). In
search of such features, polysaccharide-specific stains
were applied (Figs. 4, 5). In ultrathin sections of the algal
cell walls, a thin irregular layer on the surface of the
Prasiolopsis cell walls was observed (Fig. 4e, arrows),
whereas the cell walls of Apatococcus did not show any
additional layers (Fig. 4b). To detect possible hetero-
polysaccharides of the cell envelope, staining with labeled
concanavalin A (Con A) was applied. In both algae, the
cell periphery showed certain fluorescence signals
(Fig. 4a, d). Localization with Con A-gold revealed, at
electron microscopic resolution, a scattered distribution of
gold markers over the whole cell wall section of Apato-
coccus (Fig. 4c), and a very distinct marked outer layer in
Prasiolopsis (Fig. 4f). This accounts for a thin layer of
exopolysaccharides (EP) in Prasiolopsis. This layer
appears to be involved in adhesion of separate Prasiol-
opsis filaments as depicted in Fig. 5. Here, the cells
adhere to each other by the thin EP layer (Fig. 5b).
Discussion
Our case study aims at the elucidation of surface stains
caused by microbial impact. Besides general climatic fea-
tures (such as precipitation, insolation or temperature),
especially local factors (the effect of honeydew) determine
the biofilm formation and its taxonomic composition.
The sampling site in Hamburg experiences an oceanic
climate, with average annual precipitation of 774 mm and an
average annual temperature of 9C. The average tempera-
ture in May 2008, however, was approximately 15C (3C
higher than the long-time average for May). Precipitation
was just about 25% of the long-time average for May
(54 mm) (data were taken from Deutscher Wetterdienst,
Offenbach). Thus, the biofilms developed under relatively
warm and dry conditions. It is, however, still difficult to draw
a relation between climate and the detected organisms: most
of the detected species are distributed worldwide, with
seemingly broad ecological amplitude, a finding typical for
most microorganisms known so far (c.f. Finlay and Esteban,
2004). Thus, a ‘‘biogeography’’ of microbial species is yet to
be revealed (Hedlund and Staley 2004; Martiny et al. 2006).
From the data presented here, however, one feature is
obvious. Molecular analysis of 18S rDNA clone libraries
from sample B revealed a high diversity of ascomycete
fungi, as compared with sample A, dominated by algae
(Table 2). Sample B was taken from an area intensively
soiled by honeydew. Sample A was taken from a cavity
(Fig. 1b), where, due to the complex geometry of the
sculpture, immediate soiling with honeydew can be exclu-
ded. Here, the photoautotrophic algae are dominant. These
cavities will retain rainwater for longer time than the
exposed surfaces. Rainwater may also transport some dis-
solved carbohydrates (see below) from the honeydew layer
to the cavity but, in toto, the conditions are obviously more
favorable for algae than for ascomycetes.
Intriguingly, among the most frequently found clones
from sample B, the closest related species are known as
A
C
B
D
10 µm
10 µm 10 µm
10 µm
Fig. 3 Morphotypes of
investigated algal stains.
a Stichococcus sp.,
b Apatococcus lobatus SAG
2037, c a xanthophycean algae,
d Prasiolopsis sp.
1706 Environ Earth Sci (2011) 63:1701–1711
123
plant associated or plant pathogenic. Batcheloromyces
proteae and Teratospora (Mycosphaerella) microspora are
(opportunistic) pathogens, which are causative agents of
black leaf spot disease (Crous et al. 2004). Also Spencer-
martinsia sp. is a plant-inhabiting fungus and an opportu-
nistic phytopathogen (Phillips et al. 2008), as well as
Xenomeris raetica. Members of the genus Xenomeris are
possibly infectious agents of tree canker (Jasalavich et al.
2000). Phialophora comprises plant- and human-patho-
genic species, as well as saprophytic, wood-decaying non-
pathogens (Abliz et al. 2004). Guignardia magniferae is an
endophytic, but not necessarily a plant-pathogenic, fungus
(Suryanarayanan et al. 2004). Undoubtedly, the plant-
associated fungi were transferred from the tree canopies to
the marble surface, by honeydew droplets. Honeydew is a
carbohydrate-rich secretion mainly consisting of monosac-
charides, as well as the trisaccharide melezitose (O-a-D-
glucopyranosyl-(?3)-O-b-D-fructofuranosyl-(2?)-a-D-
glucopyranoside), which can be easily used by fungi and
other microorganisms as growth substrates (Fischer et al.
2002). The concentration of amino acids in honeydew is
relatively low (in the range of 3–20 nmol/ll), which is a
growth-limiting factor. However, the overall nitrogen input
(also from atmospheric sources) is sufficient for the devel-
opment of plant-associated fungi: such as other oligotrophic
fungi, they are well adapted to the plant biomass with wide
C/N ratios (Wainright et al. 1993 and references therein).
Massive colonization of black-pigmented ascomycete
fungi (‘‘black fungi’’, Dematiaceae) has been frequently
observed in conjunction with honeydew coverings of sur-
faces (e.g., Crozier 1981; Gerson 1975). On leaves of
affected plants, colonization is referred to as sooty mold.
Sooty mold is also a common disease on plane and linden
trees (Hughes 1976). Among other genera, also Aureoba-
sidium species have been described for the normal phyll-
osphere as well as for sooty mold. Aureobasidium is not
just a plant-associated ascomycete. Members of this genus,
as well as the detected Sarcinomyces, frequently occur on
rock and dimension stone surfaces (Simonovicova et al.
2004; Wollenzien et al. 1997). Organisms of this group
have been identified as deteriorative rock-dwelling agents
on natural and dimension stone (Gorbushina et al. 1993;
Gorbushina and Krumbein 2000). The black pigmentation
is attributed to the ultraviolet-protective melanin (Bell and
Wheeler 1986). In fungi, melanin is synthesized via dif-
ferent pathways, frequently from acetate via 1, 8-dihy-
droxynaphthalene as intermediate. The resulting phenolic
polymer is deposited in- or outside the fungal cell wall
Table 2 18S rDNA analysis of clones obtained from environmental
samples
Closest relative species Number of clones % sequence
similarity to
closest relative
species
(sample A) (sample B)
Algae
Stichococcus mirabilis 10 24 98–99
Uncultured Trebouxia sp. 1 1 97–98
Apatococcus sp. 2 – 98–99
Stichococcus sp. 1 1 99
Stichococcus jenerensis 1 – 98
Chloroidium mirabilis 1 – 98
Stichococcus bacillaris 1 – 96
Acomycete fungi
Batcheloromyces proteae 5 98–99
Teratosphaeria
microspora
3 96
Thelocarpon laureri 3 95–97
Sarcinomyces sp. 2 93–97
Guignardia mangiferae 1 100
Phaeoramularia
hachijoensis
1 98
Phialophora sp. 1 98
Conisporium perforans 1 97
Spencermartinsia sp. 1 97
Xenomeris raetica 1 97
Symbiotaphrina kochii 1 97
Mycocalicium
polyporaeum
1 96
Aureobasidium pullulans 1 95
Harpidium rutilans 1 95
Pseudofusicoccum
stromaticum
1 93
Table 3 18S rDNA analysis of
clones obtained from
enrichment cultures
Closest relative species Number of clones % sequence similarity
to closest relative species
(sample A) (sample B)
Algae
Stichococcus bacillaris 21 12 98–100
Chloroidium ellipsoideum 4 2 98–100
Chloroidium angustoellipsoideum 3 1 99
Stichococcus mirabilis – 3 98
Stichococcus deasonii 2 – 100
Environ Earth Sci (2011) 63:1701–1711 1707
123
(Bartnicki-Garcia 1968). Hence, the dark stain is difficult
to handle. Though superficial soiling, even black gypsum
crusts on top of a surface are removable with mild chemical
or biological agents (e.g., Polo et al. 2010), the organisms
and stains may also penetrate the genuine marble surface
(cf. Fig. 1e). When these cell wall remnants cannot be
removed mechanically, or by application of mild deter-
gents, rather harsh chemical treatment, e.g., with hydrogen
peroxide as strong oxidant, is necessary to destroy the
melanin (Korytowski and Sarna 1990).
According to the clone library data, the group of plant-
associated ascomycetes dominates over the rock-inhabiting
genera. Though even sequencing clone libraries to satura-
tion (which was not done here) does not reflect the real
species diversity exactly (Jeon et al. 2008), we find in our
case study a clear tendency for the presence of ‘‘allochth-
onous’’, not genuinely rock-inhabiting fungi. The organ-
isms grow in the honeydew cover on the marble sculpture,
whereas the ‘‘autochthonous’’ organisms do not benefit
from the honeydew in the same way.
In contrast, the algal species of the genus Stichococcus
are typical colonizers of stone surfaces (cf. e.g., Michailyuk
2008). It is noticeable that, though the algae are photoau-
totrophic, they may also benefit from external organic
0.1 µm
A 10 µm
100 µm
0.1 µm
0.1 µm0.1 µm
D
B E
C F
10 µm
Fig. 4 Light and electron
microscopy of lectin-labeled
cells. a Fluorescence light
microscopy of a Con A-FITC-
labeled Apatococcus aggregate.
b Ultrathin section of an
Apatococcus cell wall. c Con A-
gold labeled ultrathin section of
an Apatococcus cell wall. Dark
dots represent the colloidal gold
marker. d Fluorescence light
microscopy of Con A-FITC-
labeled Prasiolopsis filaments.
The inset shows a typical
aggregate (phase contrast
image). e Ultrathin section of a
Prasiolopsis cell wall. The thin
exopolysaccharide layer is
marked by arrows. f Con A
gold-labeled ultrathin section of
a Prasiolopsis cell wall
1708 Environ Earth Sci (2011) 63:1701–1711
123
nutrients, especially from sucrose (e.g., Samejima and
Myers 1958). Growth enhancement by carbohydrates has
also been shown for Stichococcus mirabilis (Mattox and
Bold 1962). This may be one reason for the abundance of
this algal species in a biofilm dominated by diverse fungi.
Generally, the most abundant algal species were small uni-
cellular morphotypes, known as pioneer organisms (e.g.,
Garty 1992; Bellinzoni et al. 2003). Besides these organ-
isms, others must be present in very low numbers of indi-
viduals, as a ‘‘seed bank’’ inside the biofilm (Table 3).
Hence, their sequences were not present in the clone
libraries, derived from environmental DNA. They will
become important when environmental conditions change
(which is, in fact, the case during enrichment of organisms
from biofilm samples in a liquid culture). Some species may
even not be detected in clone libraries of enrichment cul-
tures, such as, in our example, Prasiolopsis sp., a green alga
that could be obtained in unialgal culture. Prasiolopsis is a
peculiar subaerial alga living on rock or tree bark with
multiseriate filamentous or pseudo-parenchymatous thalli
(Karsten et al. 2005). Branched filaments are well adapted to
those environments where tiny paths and small cavities, as
well as impassable (crystalline) particles form a more or less
solid substratum (e.g., Ritz and Young 2004). Moreover, the
algal exopolysaccharides (EP) facilitate the attachment to a
surface as well as agglutination of organisms to each other.
Up to now, mainly thick algal EP layers in aquatic biofilms
have been described (see Sutherland 2001 for review),
where green algae and cyanobacteria are covered with a
thick polysaccharide layer. It is also known that EP stabilizes
terrestrial (soil) biofilms such as microbiotic soil crusts
(Hoppert et al. 2004b; Bowker et al. 2008). The role of EP on
dry, solid surfaces is much less known, though it is obvious
that the organisms also produce these extracellular poly-
mers. For detection of specific oligosaccharides in EP,
marker techniques based on the binding of lectins to certain
oligosaccharides stretches are used. The lectin concanavalin
A binds to oligomannose-type N-glycans. These motifs are
common in cell wall polysaccharides and especially in EP of
a variety of organisms, including cyanobacteria and
eukaryotic algae (Mehta and Vaidya 1978; Tien et al. 2005).
The Apatococcus strain does not show a layer adjacent
to the cell wall, though the rigid wall itself exhibits a
dispersed labeling (Fig. 4c). Heteropolysaccharides of
different proportions are common in algal cell walls
(Takeda and Hirokawa 1984; Okuda 2002) and can also be
expected for Apatococcus. Prasiolopsis, in contrast, forms
a thin layer of just several tens of nm in thickness, dis-
tinctively labeled with the concanavalin A-lectin (Fig. 4e,
f). Compared with other EP layers from eukaryotic algae
(e.g., Leppard 1995), Prasiolopsis exhibits even in the
hydrated state only a thin EPS coating. This layer may not
have more than a gluing function. Up to now, there are no
data concerning the interaction between the filaments and a
material surface, but it is obvious that single filaments
agglutinate via the thin EP layer (Fig. 5). This may be an
important feature for the formation of an interwoven
meshwork of branched filaments.
Conclusion
In our case study, we examined the microbial diversity on a
monument contaminated by honeydew. Remarkably, typi-
cal rock-inhabiting fungi appear to be less relevant than
plant-inhabiting fungal microorganisms. Less contami-
nated areas of the sculpture exhibited typical green algal
biofilms. Among the algae, unicellular Stichococcus-,
Chloroidium- and Apatococcus-related strains were domi-
nant in environmental samples and in enrichment cultures.
Other algae, like Prasiolopsis, could also be isolated.
These results show the high relevance of an external
carbon source (honeydew) for surface colonization by
ascomycete fungi and, hence, formation of a dark-stained
A
B
0.1 µm
10 µm
Fig. 5 Agglutination of Prasiolopsis filaments. a Fluorescence light
microscopy of two attached filaments. b The same situation as
depicted in a visualized by electron microscopy. Two attached
filaments agglutinate via a thin exopolysaccharide layer, labeled with
the Con A-gold maker
Environ Earth Sci (2011) 63:1701–1711 1709
123
biofilm layer. The dark surface stain can only be avoided by
removal of the carbon source, e.g., the honeydew, which may
be achieved by suitable pest control. Also, an appropriate
shaping of the canopy may lead, in this case, to an effect:
parts of the sculptures are presently positioned in a way that
they are placed rather under the periphery of the tree cano-
pies. Thinning of the crown may not completely prevent, but
reduce, the impact of down-dripping honeydew.
Acknowledgments The support of Mrs Ruth Hauer (Denkmals-
chutzamt Hamburg) during the field work is gratefully acknowledged.
Open Access This article is distributed under the terms of the
Creative Commons Attribution Noncommercial License which per-
mits any noncommercial use, distribution, and reproduction in any
medium, provided the original author(s) and source are credited.
References
Abliz P, Fukushima K, Takizawa K, Nishimura K (2004) Identifica-
tion of pathogenic dematiaceous fungi and related taxa based on
large subunit ribosomal DNA D1/D2 domain sequence analysis.
FEMS Immunol Med Microbiol 40:41–49
Adams AE, MacKenzie WS, Guilford C (1984) Atlas of sedimentary
rocks under the microscope. Longman Publ. Group, New York
Ascaso C, Wierzchos J, Castello R (1998) Study of the biogenic
weathering of calcareous litharenite stones caused by lichen and
endolithic microorganisms. Intl Biodeterior Biodegrad 42:29–38
Bartnicki-Garcia S (1968) Cell wall chemistry, morphogenesis and
taxonomy of fungi. Annu Rev Microbiol 22:87–108
Bell AA, Wheeler MH (1986) Biosynthesis and functions of fungal
melanins. Annu Rev Phytopathol 24:411–451
Bellinzoni AM, Caneva G, Ricci S (2003) Ecological trends in
travertine colonisation by pioneer algae and plant communities.
Intl Biodet Biodegrad 51:203–210
Bowker MAG, Koch W, Belnap J, Johnson NC (2008) Nutrient
availability affects pigment production but not growth in lichens
of biological soil crusts. Soil Biol Biochem 40:2819–2826
Cooke WB (1961) A taxonomic study in the ‘‘black yeasts’’.
Mycopathologia 17:1–43
Crous PW, Denman S, Taylor JE, Swart L, Palm ME (2004)
Cultivation and diseases of Proteaceae: Leucadendron, Leuco-
spermum and Protea. CBS Biodiv Ser 2:1–226
Crozier L (1981) Beech honeydew: forest produce. New Zeal J Forest
26:200–209
Darienko T, Gustavs L, Mudimu O, Rad Menendez C, Schumann R,
Karsten U, Friedl T, Pro¨schold T (2010) Chloroidium, a common
terrestrial coccoid green alga previously assigned to Chlorella
(Trebouxiophyceae, Chlorophyta). Eur J Phycol 45:1469–4433
Finlay BJ, Esteban GF (2004) Ubiquitous dispersal of free-living
microorganisms. In: Bull AT (ed) Microbial diversity and
bioprospecting. ASM Press, Washington, pp 216–224
Fischer MK, Vo¨lkl W, Schopf R, Hoffmann KH (2002) Age-specific
patterns in honeydew production and honeydew composition in
the aphid Metopeurum fuscoviride: implications for ant-atten-
dance. J Insect Physiol 48:319–326
Friedl T (1996) Evolution of the polyphyletic genus Pleurastrum
(Chlorophyta): inference from nuclear-encoded ribosomal DNA
sequences and motile cell ultrastructure. Phycologia 35:456–469
Garty J (1992) The postfire recovery of rock-inhabiting algae,
microfungi and lichens. Can J Bot 70:310–312
Gerson U (1975) A soft scale as an urban pest. Isr J Entomol
10:25–28
Gorbushina AA (2007) Life on the rocks. Environ Microbiol
9:613–631
Gorbushina AA, Krumbein WE (2000) Rock dwelling fungal
communities: diversity of life styles and colony structure. In:
Seckbach J (ed) Journey to diverse microbial worlds. Kluwer,
Amsterdam, pp 317–334
Gorbushina AA, Krumbein WE, Hamman CH, Panina L, Soukharjev-
ski S, Wollenzien U (1993) Role of black fungi in colour change
and biodeterioration of antique marbles. Geomicrobiol J
11:205–221
Hamby RK, Sim LE, Zimmer EA (1988) Direct RNA sequencing
techniques for work with higher plants. Plant Mol Biol Reporter
6:179–197
Hedlund BP, Staley JT (2004) Microbial endemism and biogeogra-
phy. In: Bull AT (ed) Microbial diversity and bioprospecting.
ASM Press, Washington, pp 225–231
Hoppert M, Holzenburg A (1998) Electron microscopy in microbi-
ology. Bios Scientific Publ, London
Hoppert M, Flies C, Pohl W, Gu¨nzl B, Schneider J (2004a)
Colonization strategies of lithobiontic organisms on carbonate
rocks. Environ Geol 46:4212–4428
Hoppert M, Reimer R, Kemmling A, Schro¨der A, Gu¨nzl B, Heinken T
(2004b) Structure and reactivity of a biological soil crust from a
xeric sandy soil in Central Europe. Geomicrobiol J 21:183–191
Hughes SJ (1976) Sooty molds. Mycologia 68:693–820
Jasalavich CA, Ostrofsky A, Jellison J (2000) Detection and
identification of decay fungi in spruce wood by restriction
fragment length polymorphism analysis of amplified genes
encoding rRNA. Appl Environ Microbiol 66:4725–4734
Jeon S, Bunge J, Leslin C, Stoeck T, Hong S, Epstein SS (2008)
Environmental rRNA inventories miss over half of protistan
diversity. BMC Microbiol 8:222
Ka¨mper M, Vetterkind S, Berker R, Hoppert M (2004) Methods for in
situ detection and characterization of extracellular polymers in
biofilms by electron microscopy. J Microbiol Meth 57:55–64
Karsten U, Friedl T, Schumann R, Hoyer K, Lembcke S (2005)
Mycosporine-like amino acids and phylogenies in green algae:
Prasiola and its relatives from the Trebouxiophyceae (Chloro-
phyta). J Phycol 41:557–566
Kemmling A, Ka¨mper M, Flies C, Schieweck O, Hoppert M (2004)
Biofilms and extracellular matrices on geomaterials. Environ
Geol 46:429–435
Korytowski W, Sarna T (1990) Bleaching of melanin pigments. J Biol
Chem 265:12410–12416
Leppard GG (1995) The characterization of algal and microbial
mucilages and their aggregates in aquatic ecosystems. Sci Total
Environ 165:103–131
Macedo MF, Miller AZ, Dionisio A, Saiz-Jimenez C (2009)
Biodiversity of cyanobacteria and green algae on monuments
in the Mediterranean Basin: an overview. Microbiology
155:3476–3490
Martiny JB, Bohannan BJ, Brown JH, Colwell RK, Fuhrman JA,
Green JL, Horner-Devine MC, Kane M, Krumins JA, Kuske CR,
Morin PJ, Naeem S, Ovrea˚s L, Reysenbach AL, Smith VH,
Staley JT (2006) Microbial biogeography: putting microorgan-
isms on the map. Nat Rev Microbiol 4:102–112
Mattox K, Bold HC (1962) Phycological studies III. The taxonomy
of certain ulotricacean algae. Univ Texas Publ No 6222,
Austin
Mehta VB, Vaidya BS (1978) Cellular and extracellular polysaccha-
rides of the blue-green alga Nostoc. J Exp Bot 29:1423–1430
Meusnier I, Singer GAC, Landry J-F, Hickey DA, Hebert PDN,
Hajibabaei M (2008) A universal DNA mini-barcode for
biodiversity analysis. BMC Genomics 9:214
1710 Environ Earth Sci (2011) 63:1701–1711
123
Michailyuk TI (2008) Terrestrial lithophilic algae in a granite canyon
of the Teteriv River (Ukraine). Biologia 63:824–830
Okuda K (2002) Structure and phylogeny of cell coverings. J Plant
Res 115:283–288
Phillips AJL, Alves A, Pennycook SR, Johnston PR, Ramaley A,
Akulov A, Crous PW (2008) Resolving the phylogenetic and
taxonomic status of dark-spored teleomorph genera in the
Botryosphaeriaceae. Persoonia 21:29–55
Polo A, Cappitelli F, Brusetti L, Principi P, Villa F, Giacomucci L,
Ranalli G, Sorlini C (2010) Feasibility of removing surface
deposits on stone using biological and chemical remediation
methods. Microb Ecol 60:1–14
Ritz K, Young IM (2004) Interactions between soil structure and
fungi. Mycologist 18:52–59
Roth J, Bendayan M, Carlemalm E, Villiger W, Garavito M (1981)
Enhancement of structural preservation and immunocytochem-
ical staining in low temperature embedded pancreatic tissue.
J Histochem Cytochem 29:663–671
Samejima H, Myers J (1958) On the heterotrophic growth of
Chlorella pyrenoidosa. J Gen Microbiol 18:107–117
Schlo¨sser UG (1994) Sammlung von Algenkulturen at the University
of Go¨ttingen; catalogue of strains 1994. Bot Acta 107:113–186
Simonovicova A, Godyova M, Svec J (2004) Airborne and soil
microfungi as contaminants of stone in a hypogean cemetery. Int
Biodeter Biodegrad 54:7–11
Suryanarayanan TS, Ravishankar JP, Venkatesan G, Murali TS
(2004) Characterization of the melanin pigment of a cosmopol-
itan fungal endophyte. Mycol Res 108:974–978
Sutherland IW (2001) Biofilm exopolysaccharides: a strong and
sticky framework. Microbiology 147:3–9
Takeda H, Hirokawa T (1984) Studies on the cell wall of Chlorella V.
Comparison of the cell wall chemical compositions in strains of
Chlorella ellipsoidea. Plant Cell Physiol 25:287–295
Tien CJ, Sigee DC, White KN (2005) Characterization of surface
sugars on algal cells with fluorescein isothiocyanate-conjugated
lectins. Protoplasma 225:225–233
Tsuneda S, Aikawa H, Hayashi H, Yuasa A, Hirata A (2003)
Extracellular polymeric substances responsible for bacterial
adhesion onto solid surface. FEMS Microbiol Lett 223:287–292
Wainright M, Ali TA, Barakh F (1993) A review of the role of
oligotrophic microorganisms in biodeterioration. Int Biodeter
Biodegrad 31:1–13
Warscheid T, Braams J (2000) Biodeterioration of stone: a review. Int
Biodeter Biodegrad 46:343–368
White TJ, Bruns T, Lee S, Talylor J (1990) Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics.
PCR protocols: a guide to methods and applications, pp 315–322
Wollenzien U, de Hog GS, Krumbein W, Uijthof JMJ (1997)
Sarcinomyces petricola, a new microcolonial fungus from
marble in the Mediterranean basin. Antonie van Leeuwenhoek
71:281–288
Zuo R, Kus E, Mansfeld F, Wood TK (2005) The importance of live
biofilms in corrosion protection. Corros Sci 47:279–287
Environ Earth Sci (2011) 63:1701–1711 1711
123